Annotation history of precursor miRNA MI0007798 in

Perform new search




11.0
!
April 2008
miRBase release accession number name sequence mature product(s) change(s) in record
11.0 MI0007798 mml-mir-519d
UCCCAAGCUGUGACCCUCCAAAGGG
AAGCACUUUCUGUUUGUUGUCUGAG
AGAAAACAAAGUGCUUCCUUUUAGA
GUGUGACCGCUUGGGA
MIMAT0006387 record created
Retrieve in miRBase


Please use the following citation when referring to miRBase Tracker:

miRBase Tracker: keeping track of microRNA annotation changes
Gert Van Peer; Steve Lefever; Jasper Anckaert; Anneleen Beckers; Ali Rihani; Alan Van Goethem; Pieter-Jan Volders; Fjoralba Zeka; Mate Ongenaert; Pieter Mestdagh; Jo Vandesompele
Database 2014; doi: 10.1093/database/bau080