Warning: filesize(): stat failed for /var/tmp/event_sequences.out in /home/www/mirbasetracker/index.php on line 293 Call Stack: 0.0069 1567200 1. {main}() /home/www/mirbasetracker/index.php:0 0.0205 1996744 2. filesize() /home/www/mirbasetracker/index.php:293 Warning: unlink(/var/tmp/event_sequences.dnd): No such file or directory in /home/www/mirbasetracker/index.php on line 353 Call Stack: 0.0069 1567200 1. {main}() /home/www/mirbasetracker/index.php:0 0.0207 1998824 2. unlink() /home/www/mirbasetracker/index.php:353 miRBase Tracker

Annotation history of precursor miRNA MI0007680 in

Perform new search




11.0
!
April 2008
20
!
June 2013
miRBase release accession number name sequence mature product(s) change(s) in record
11.0 MI0007680 mml-mir-222
GCUGCUGGAAGGUAUAGGUACCCUC
AAUGGCUCAGUAGCCAGUGUAGAUC
CUGUCUUUCGUAAUCAGCAGCUACA
UCUGGCUACUGGGUCUCUGAUGGCA
UCUUCUAGCU
MIMAT0006250 record created
20 MI0007680 mml-mir-222
GCUGCUGGAAGGUAUAGGUACCCUC
AAUGGCUCAGUAGCCAGUGUAGAUC
CUGUCUUUCGUAAUCAGCAGCUACA
UCUGGCUACUGGGUCUCUGAUGGCA
UCUUCUAGCU
MIMAT0026849,MIMAT0006250 mature product(s)
Retrieve in miRBase


Please use the following citation when referring to miRBase Tracker:

miRBase Tracker: keeping track of microRNA annotation changes
Gert Van Peer; Steve Lefever; Jasper Anckaert; Anneleen Beckers; Ali Rihani; Alan Van Goethem; Pieter-Jan Volders; Fjoralba Zeka; Mate Ongenaert; Pieter Mestdagh; Jo Vandesompele
Database 2014; doi: 10.1093/database/bau080