Annotation history of precursor miRNA MI0004913 in

Perform new search




8.1
!
May 2006
miRBase release accession number name sequence mature product(s) change(s) in record
8.1 MI0004913 xtr-mir-23b
CCGGUGUGGCUGUUUGGGUUCCUGG
CAUGCUGAUUUGUGAGUUAAGAUUA
AAAUCACAUUGCCAGGGAUUACCAC
ACAACCAUGUCCU
MIMAT0003673 record created
Retrieve in miRBase


Please use the following citation when referring to miRBase Tracker:

miRBase Tracker: keeping track of microRNA annotation changes
Gert Van Peer; Steve Lefever; Jasper Anckaert; Anneleen Beckers; Ali Rihani; Alan Van Goethem; Pieter-Jan Volders; Fjoralba Zeka; Mate Ongenaert; Pieter Mestdagh; Jo Vandesompele
Database 2014; doi: 10.1093/database/bau080