Warning: filesize(): stat failed for /var/tmp/event_sequences.out in /home/www/mirbasetracker/index.php on line 293 Call Stack: 0.0072 1567200 1. {main}() /home/www/mirbasetracker/index.php:0 0.0222 1996672 2. filesize() /home/www/mirbasetracker/index.php:293 Warning: unlink(/var/tmp/event_sequences.dnd): No such file or directory in /home/www/mirbasetracker/index.php on line 353 Call Stack: 0.0072 1567200 1. {main}() /home/www/mirbasetracker/index.php:0 0.0224 1998688 2. unlink() /home/www/mirbasetracker/index.php:353 miRBase Tracker

Annotation history of precursor miRNA MI0002147 in

Perform new search




7.0
!
June 2005
21
!
June 2014
miRBase release accession number name sequence mature product(s) change(s) in record
7.0 MI0002147 dre-mir-430b-7
CAGUUGACGUCAACUCUAACUUUAG
CAUCUUUCUUUUAAGCAGAGUAGAA
AGUGCUAUCAAGUUGGGGUAGAUGU
UUGCUG
MIMAT0001424 record created
21 MI0002147 dre-mir-430b-7
CAGUUGACGUCAACUCUAACUUUAG
CAUCUUUCUUUUAAGCAGAGUAGAA
AGUGCUAUCAAGUUGGGGUAGAUGU
UUGCUG
MIMAT0031928,MIMAT0001424 mature product(s)
Retrieve in miRBase


Please use the following citation when referring to miRBase Tracker:

miRBase Tracker: keeping track of microRNA annotation changes
Gert Van Peer; Steve Lefever; Jasper Anckaert; Anneleen Beckers; Ali Rihani; Alan Van Goethem; Pieter-Jan Volders; Fjoralba Zeka; Mate Ongenaert; Pieter Mestdagh; Jo Vandesompele
Database 2014; doi: 10.1093/database/bau080