Warning: filesize(): stat failed for /var/tmp/event_sequences.out in /home/www/mirbasetracker/index.php on line 293 Call Stack: 0.0082 1567200 1. {main}() /home/www/mirbasetracker/index.php:0 0.0274 1996696 2. filesize() /home/www/mirbasetracker/index.php:293 Warning: unlink(/var/tmp/event_sequences.dnd): No such file or directory in /home/www/mirbasetracker/index.php on line 353 Call Stack: 0.0082 1567200 1. {main}() /home/www/mirbasetracker/index.php:0 0.0276 1998744 2. unlink() /home/www/mirbasetracker/index.php:353 miRBase Tracker

Annotation history of precursor miRNA MI0001387 in

Perform new search




5.0
!
September 2004
21
!
June 2014
miRBase release accession number name sequence mature product(s) change(s) in record
5.0 MI0001387 dre-mir-221
GUCGUGAACCUGGCAUACAAUGUAG
AUUUCUGUGUGGUACUAUCUACAGC
UACAUUGUCUGCUGGGUUUCAGGCC
AGCAGAAUAAUUCUGCUC
dre-miR-221 record created
21 MI0001387 dre-mir-221
GUCGUGAACCUGGCAUACAAUGUAG
AUUUCUGUGUGGUACUAUCUACAGC
UACAUUGUCUGCUGGGUUUCAGGCC
AGCAGAAUAAUUCUGCUC
MIMAT0031926,MIMAT0001288 mature product(s)
Retrieve in miRBase


Please use the following citation when referring to miRBase Tracker:

miRBase Tracker: keeping track of microRNA annotation changes
Gert Van Peer; Steve Lefever; Jasper Anckaert; Anneleen Beckers; Ali Rihani; Alan Van Goethem; Pieter-Jan Volders; Fjoralba Zeka; Mate Ongenaert; Pieter Mestdagh; Jo Vandesompele
Database 2014; doi: 10.1093/database/bau080