Warning: filesize(): stat failed for /var/tmp/event_sequences.out in /home/www/mirbasetracker/index.php on line 293 Call Stack: 0.0071 1567816 1. {main}() /home/www/mirbasetracker/index.php:0 0.0245 1997376 2. filesize() /home/www/mirbasetracker/index.php:293 Warning: unlink(/var/tmp/event_sequences.dnd): No such file or directory in /home/www/mirbasetracker/index.php on line 353 Call Stack: 0.0071 1567816 1. {main}() /home/www/mirbasetracker/index.php:0 0.0247 1999408 2. unlink() /home/www/mirbasetracker/index.php:353 miRBase Tracker

Annotation history of precursor miRNA MI0000461 in

Perform new search




2.0
!
July 2003
10.0
!
August 2007
miRBase release accession number name sequence mature product(s) change(s) in record
2.0 MI0000461 hsa-mir-145
CACCUUGUCCUCACGGUCCAGUUUU
CCCAGGAAUCCCUUAGAUGCUAAGA
UGGGGAUUCCUGGAAAUACUGUUCU
UGAGGUCAUGGUU
hsa-miR-145 record created
10.0 MI0000461 hsa-mir-145
CACCUUGUCCUCACGGUCCAGUUUU
CCCAGGAAUCCCUUAGAUGCUAAGA
UGGGGAUUCCUGGAAAUACUGUUCU
UGAGGUCAUGGUU
MIMAT0000437,MIMAT0004601 mature product(s)
Retrieve in miRBase


Please use the following citation when referring to miRBase Tracker:

miRBase Tracker: keeping track of microRNA annotation changes
Gert Van Peer; Steve Lefever; Jasper Anckaert; Anneleen Beckers; Ali Rihani; Alan Van Goethem; Pieter-Jan Volders; Fjoralba Zeka; Mate Ongenaert; Pieter Mestdagh; Jo Vandesompele
Database 2014; doi: 10.1093/database/bau080