Warning: filesize(): stat failed for /var/tmp/event_sequences.out in /home/www/mirbasetracker/index.php on line 293 Call Stack: 0.0072 1567816 1. {main}() /home/www/mirbasetracker/index.php:0 0.0250 1997424 2. filesize() /home/www/mirbasetracker/index.php:293 Warning: unlink(/var/tmp/event_sequences.dnd): No such file or directory in /home/www/mirbasetracker/index.php on line 353 Call Stack: 0.0072 1567816 1. {main}() /home/www/mirbasetracker/index.php:0 0.0251 1999504 2. unlink() /home/www/mirbasetracker/index.php:353 miRBase Tracker

Annotation history of precursor miRNA MI0000285 in

Perform new search




1.2
!
April 2003
13.0
!
March 2009
miRBase release accession number name sequence mature product(s) change(s) in record
1.2 MI0000285 hsa-mir-205
AAAGAUCCUCAGACAAUCCAUGUGC
UUCUCUUGUCCUUCAUUCCACCGGA
GUCUGUCUCAUACCCAACCAGAUUU
CAGUGGAGUGAAGUUCAGGAGGCAU
GGAGCUGACA
hsa-miR-205 record created
13.0 MI0000285 hsa-mir-205
AAAGAUCCUCAGACAAUCCAUGUGC
UUCUCUUGUCCUUCAUUCCACCGGA
GUCUGUCUCAUACCCAACCAGAUUU
CAGUGGAGUGAAGUUCAGGAGGCAU
GGAGCUGACA
MIMAT0000266,MIMAT0009197 mature product(s)
Retrieve in miRBase


Please use the following citation when referring to miRBase Tracker:

miRBase Tracker: keeping track of microRNA annotation changes
Gert Van Peer; Steve Lefever; Jasper Anckaert; Anneleen Beckers; Ali Rihani; Alan Van Goethem; Pieter-Jan Volders; Fjoralba Zeka; Mate Ongenaert; Pieter Mestdagh; Jo Vandesompele
Database 2014; doi: 10.1093/database/bau080