Warning: filesize(): stat failed for /var/tmp/event_sequences.out in /home/www/mirbasetracker/index.php on line 293 Call Stack: 0.0079 1567200 1. {main}() /home/www/mirbasetracker/index.php:0 0.0282 2000232 2. filesize() /home/www/mirbasetracker/index.php:293 Warning: unlink(/var/tmp/event_sequences.dnd): No such file or directory in /home/www/mirbasetracker/index.php on line 353 Call Stack: 0.0079 1567200 1. {main}() /home/www/mirbasetracker/index.php:0 0.0284 2002600 2. unlink() /home/www/mirbasetracker/index.php:353 miRBase Tracker

Annotation history of precursor miRNA MI0000098 in

Perform new search




1.1
!
January 2003
1.2
!
April 2003
10.0
!
August 2007
miRBase release accession number name sequence mature product(s) change(s) in record
1.1 MI0000098 hsa-mir-96-7
UGGCCGAUUUUGGCACUAGCACAUU
UUUGCUUGUGUCUCUCCGCUCUGAG
CAAUCAUGUGCAGUGCCAAUAUGGG
AAA
hsa-miR-96 record created
1.2 MI0000098 hsa-mir-96
UGGCCGAUUUUGGCACUAGCACAUU
UUUGCUUGUGUCUCUCCGCUCUGAG
CAAUCAUGUGCAGUGCCAAUAUGGG
AAA
hsa-miR-96 name, mature product(s)
10.0 MI0000098 hsa-mir-96
UGGCCGAUUUUGGCACUAGCACAUU
UUUGCUUGUGUCUCUCCGCUCUGAG
CAAUCAUGUGCAGUGCCAAUAUGGG
AAA
MIMAT0000095,MIMAT0004510 mature product(s)
Retrieve in miRBase


Please use the following citation when referring to miRBase Tracker:

miRBase Tracker: keeping track of microRNA annotation changes
Gert Van Peer; Steve Lefever; Jasper Anckaert; Anneleen Beckers; Ali Rihani; Alan Van Goethem; Pieter-Jan Volders; Fjoralba Zeka; Mate Ongenaert; Pieter Mestdagh; Jo Vandesompele
Database 2014; doi: 10.1093/database/bau080