Warning: filesize(): stat failed for /var/tmp/event_sequences.out in /home/www/mirbasetracker/index.php on line 293 Call Stack: 0.0072 1567200 1. {main}() /home/www/mirbasetracker/index.php:0 0.0266 2000192 2. filesize() /home/www/mirbasetracker/index.php:293 Warning: unlink(/var/tmp/event_sequences.dnd): No such file or directory in /home/www/mirbasetracker/index.php on line 353 Call Stack: 0.0072 1567200 1. {main}() /home/www/mirbasetracker/index.php:0 0.1738 2002560 2. unlink() /home/www/mirbasetracker/index.php:353 miRBase Tracker

Annotation history of precursor miRNA MI0000097 in

Perform new search




1.1
!
January 2003
1.2
!
April 2003
20
!
June 2013
miRBase release accession number name sequence mature product(s) change(s) in record
1.1 MI0000097 hsa-mir-95-4
AACACAGUGGGCACUCAAUAAAUGU
CUGUUGAAUUGAAAUGCGUUACAUU
CAACGGGUAUUUAUUGAGCACCCAC
UCUGUG
hsa-miR-95 record created
1.2 MI0000097 hsa-mir-95
AACACAGUGGGCACUCAAUAAAUGU
CUGUUGAAUUGAAAUGCGUUACAUU
CAACGGGUAUUUAUUGAGCACCCAC
UCUGUG
hsa-miR-95 name, mature product(s)
20 MI0000097 hsa-mir-95
AACACAGUGGGCACUCAAUAAAUGU
CUGUUGAAUUGAAAUGCGUUACAUU
CAACGGGUAUUUAUUGAGCACCCAC
UCUGUG
MIMAT0026473,MIMAT0000094 mature product(s)
Retrieve in miRBase


Please use the following citation when referring to miRBase Tracker:

miRBase Tracker: keeping track of microRNA annotation changes
Gert Van Peer; Steve Lefever; Jasper Anckaert; Anneleen Beckers; Ali Rihani; Alan Van Goethem; Pieter-Jan Volders; Fjoralba Zeka; Mate Ongenaert; Pieter Mestdagh; Jo Vandesompele
Database 2014; doi: 10.1093/database/bau080